RetrogeneDB ID: | retro_amel_1492 | ||
Retrocopy location | Organism: | Panda (Ailuropoda melanoleuca) | |
| Coordinates: | GL193493.1:76194..76431(+) | ||
| Located in intron of: | None | ||
Retrocopy information | Ensembl ID: | None | |
| Aliases: | None | ||
| Status: | NOVEL | ||
Parental gene information | Parental gene summary: | ||
| Parental gene symbol: | KRTAP21-2 | ||
| Ensembl ID: | ENSAMEG00000004065 | ||
| Aliases: | None | ||
| Description: | None |
Retrocopy-Parental alignment summary:
>retro_amel_1492
GGATATGGCTCCGGCTGTGGATATGGCTCCCGCTGTAGATATGGCTCCGGCTGTGGATATGGCTCCGGCTGTAGATATGG
CTCTGGCTGTGGCTACGGCTCTGGCTGTGGATATGGCTGTGGCTATGGCTCCCGCTATGGCTGTGGCTACGGATCTAAAT
GTGGATACGGCTGTGGCTATGGCTCTGGATCCTGTGGTTACTAACCATTTTGGTACAGAAGATGATATTCCTCTTGC
ORF - retro_amel_1492 Open Reading Frame is not conserved.
Retrocopy - Parental Gene Alignment summary:
| Percent Identity: | 71.95 % |
| Parental protein coverage: | 57.35 % |
| Number of stop codons detected: | 2 |
| Number of frameshifts detected: | 0 |
Retrocopy - Parental Gene Alignment:
| Parental | GYGSGWGCGKGSGYGCGCGYG--CGYGSGCGYGYGSGCGCGYGSRYGCGYGSGC--GCGYGSGWGCGCGY |
| GYGSG.G.G....YG.GCGYG..C.YGSGCGYG.G.G.GCGYGSRYGCGYGS.C..GCGYGSG....CGY | |
| Retrocopy | GYGSGCGYGSRCRYGSGCGYGSGCRYGSGCGYGSGCGYGCGYGSRYGCGYGSKCGYGCGYGSG---SCGY |
| Parental | RPFCYRRCYSSC |
| .PF.YRR.YSSC | |
| Retrocopy | *PFWYRR*YSSC |
Legend:
| * | Stop codon |
| > | Forward frameshift by one nucleotide |
| < | Reverse frameshift by one nucleotide |
Ailuropoda melanoleuca was not studied using RNA-Seq expression data.
Ailuropoda melanoleuca was not studied using ChIP-Seq data.
No EST(s) were mapped for retro_amel_1492 retrocopy.
Ailuropoda melanoleuca was not studied using FANTOM5 data.
retro_amel_1492 was not experimentally validated.
Retrocopy orthology:
Ailuropoda melanoleuca does not belong to any of the species groups (eutheria, teleost or neognath), studied for retrocopy-based homology. For more information about studied groups, please go to help section.Parental genes homology:
Parental genes homology involve 1 parental gene, and 1 retrocopy.| Species | Parental gene accession | Retrocopies number | |
|---|---|---|---|
| Ailuropoda melanoleuca | ENSAMEG00000004065 | 1 retrocopy |
retro_amel_1492 ,
|