Parental gene:

VIT_14s0036g00730

Aliases:None
Description:None
Organism:Grape (Vitis vinifera)
Coordinates:14:10931958..10935050(+)


>VIT_14s0036g00730
ATGCCCAAAGTGAGGAGGAAAAGTAAAATAAGTCCTGAAGCATTTGTTGTGCTTCTAGCATTCTCAAAAGTGACTTCATT
GCTGAATGATGCAAAGGCAGGTGTTCCCTTGAATGTCCCTGGAAATTCTTCTTCGACAAATGCTGCTGCAAGCAACTCAT
TACCTTCCATGTTTCCTGCTGGCAGTGCACCTCCACTGTCACCAAGAAGTATATCTGGTTCTCCTCGTGTTATGAAGCAG
AGGATTGGCCCTTCTAATTTAAGTTCTCCTCTGAAATTAGCTAGTGAGCCTGTTAGAGAATTGATACCTCAGTTTTACTT
TCAAAATGGCCGCCCACCTCCAAATGAACTAAAGGAACAATGTTTGTTTAGGATCAATCAAGTTTTCTATGATCACTTGG
ATGGACTGCAAATACATGAATTTAGATCAGTTGCTAAGGATATTTGCAAGTTGCCTACGTTCCTCTCCACTACTCTTTTC
AGAAGGATTGATGTTAATTTCACTGGGATTGTTACTAGAGAGGGAGTAATATTTTGTAGTCCCTCTTGTTTTTAG

No homologs available

# RetrogeneDB ID Identity (%) Coverage (%) ORF conservation Expression evidence RDV
1. retro_vvin_119 88.08 82.07
Please wait, loading
Please wait, loading
Please wait, loading

Download FASTA sequences of all VIT_14s0036g00730 retrocopies