Parental gene:

VIT_11s0037g01120

Aliases:None
Description:None
Organism:Grape (Vitis vinifera)
Coordinates:11:10153709..10165745(+)


>VIT_11s0037g01120
ATGGAAGAGGTTCACCTGCAAACAGCACCAGCAGATTTCCGATTTCCTAGCACAAATCAGACCAGACACTGTTTCACCCG
CTACATTGAGTTTCACCGGTGCTTGGCAGCAAAGGGGGAAGAGTCTGGTGACTGTGAAAAATTTGCCAAATACTATCGGT
CCCTTTGTCCAGTTGAATGGATTGAGAAATGGAATGAGCAGAGGGAGAATGGCACTTTCCCAGGTCCTCTTTGA

No homologs available

# RetrogeneDB ID Identity (%) Coverage (%) ORF conservation Expression evidence RDV
1. retro_vvin_60 57.35 87.01
Please wait, loading
Please wait, loading
Please wait, loading

Download FASTA sequences of all VIT_11s0037g01120 retrocopies