Parental gene:

ONIVA01G47760

Aliases:None
Description:None
Organism:Indian wild rice (Oryza nivara)
Coordinates:1:39558324..39577109(+)


>ONIVA01G47760
ATGCCAAAAGCTTCCTCTCTCTCTCTCCCTCGTCGTCGTCGTCCCTGCGCCGCGGGGCGGGGCGGGCCATTGGCCGGCGG
CGCCGACTGCGCCCGGCCGTATCTCCCCACCGCATTCCCGCGGCTACCCTGCCTATACGACACGACACTGCTAGCTCAGA
GTGGTAGCCCATTATTGGGAACCCTCAAGATGAAGAGCGTCAGAACGATCCTGACACACACATATCCATATCCTCATGAA
CACTCAAGGCATATCATGACTGCAGTCATAATTGCATGCCTCTTTTTCATCTCGTCTGACAATATGCATACCCTCATACA
TAAACTGGACAACAATATCAAGTGGTGGTCCATGTATGTCGCTTGGATTTGCTTCGCTTCACTATATCATCTTCCCAGCT
TCCAATCAATGGGAGTTGATATGCGCATGAACCTTTCACTTTTTTTGACGATATATTTCTCTTCTGTCCTTTTCATCATC
GCCTTTCATATAGTTTTTATTGGTCTCTGGTACATTGGACTGGTTGCTCGCATGGCAGGAACAAGACCTGGAATTTGGAC
CATATTCCAGAACTGTACTGTAATCAGTATTGCTTGCTGTGTATTCTACAGTCACTGTGGGAATCTTGCTGTGCACAAAA
GTAAATCTTTCAGTAGGAATTCTGATCCAAATTTGCTTGCTTTTCTTGAGAATGAAAAGGGAACCACCTGGATATCAAAT
TTTCTCCGTATGAATGAGTTAAAAGATCAGATATGTTCATCTTGGTTTGCTCCGGTTGGATCTGCTAGTGATTATCCTCT
TCTATCCAAATGGGTTATCTATGGGGAGCTAGTTTGCAGTGGATCCTGTGCTGGCCCTTCAGATGAAATATCTCCTCTGT
ACTCATTGTGGGCTACATTTGTTGGCCTTTATATTGCTAACTTTGTTGTGGAGAGATCAACTGGATGGGCTCTTACACAC
CCATCAACTGCTGCAATGAAAAGAACAACAGATGAAACTCAGAATGATGACCTTTTGTATGACTACTTCAATGAAAGAGA
AGACCTTTGGTTTGACTTTGTCGCAGACACTGGTGATGGAGGAAATTCATCATATACAGTTGCCCGATTGCTAGCTCAAC
CATCCATTCAGACTGTAATTGGTGGCTCCATGCATACTCTTCCACGTGGAAATCTGCTTCTTATTGGCGGAGACCTTGCA
TACCCAAACCCATCGTCATTTACATATGAGATGCGCTTCTTTAGTCCTTATGAGTATGCCCTGCAACCTCCACCTTGGTA
TAGAGCTGAACATATAGCTTTGGACAAGCCTGAGGTTCCTCTTGGTATATCAAAGATGAAAGATTATGACGGACCACAGT
GTTTCATAATTCCTGGGAATCATGACTGGTTTGATGGGCTGCACACTTTTATGAGATATGTATGTCACAAAAGTTGGTTA
GGTGGATGGTTTCTGCCTCAGAAGAAGAGTTATTTTGCATTGCGGCTTCCCCAGGGTTGGTGGGTATTTGGACTTGATCT
AGCTCTTCATGGTGACATTGATGTATACCAATTCAAGTTCTTTGCAGAGCTTTGCCGAAACAAGATTGGAGAGAATGACT
CTGTGATTGTGATGACACATGAGCCAAACTGGCTTCTTGATTGGTATTGGAAGGAGACTACTGGCAAGAATGTTTCACAT
TTAATCCAGGACTACTTGAATGGAAGATGCAAACTTCGTTTGGCCGGGGATTTACACCATTTTATGAGGCATTCAGCTAA
TCAGATAGACAACCCTACTTCTGTGCAACACTTGCTTGTCAATGGATGCGGTGGTGCATTTTTGCACCCAACACATGTTT
TCAAAAACTTTGAGCAGTTCTCTGGAGCTACTTATGAGTGCAAGGCTGCGTATCCATCCTTCGATGACTCCAGCGGGATT
GCGCTGGGTAATATACTAAAGTTCCGCAAGAAGAATTGGCAGTTTGACACAATTGGTGGTTTTATCTACTTCATACTGGT
ATTCTCAATGTTCCCACAGTGTAATCTTGGTCACATCTTAAATGAAGAAACTTGGTCAGGGCGTCTGGGAAGCTTCTCAA
ATACAATATGGAGTGCTTTGCTCTATATTTTTGAACACTCTTATGTCTCTTCAGTAGGAAGTCTAACTTTATTACTGGCA
TCATATTCATTTGTACCATCCAAGCTCTCACGGAGAAAAAGAGCTATTATAGGTGGTCTACATGTTTTGGCCCATCTCAC
TGCAGCCCTGCTTTTAATGTTGCTGTTGGAGTTGGGAATTGAAATTTGTATTCGGAATCATTTATTGGCAACATCAGGTT
ATCACACACTATACGATTGGTATCGGTCAATGGAAAGTGAGCATTTCCCTGATCCAACCGGTCTTCGTGCTCGCTTGGAG
CAATGGACACTTGGACTGTACCCAGCATGCATAAAATACCTAATGTCAGCCTTTGACGTTCCTGAGGTCATGGCTGTGAC
AAGAATTAATATCTGCAAGAATGGGATGATGTCTCTTTCTCGGAGTGTTCTGATGATGTACTACACTTCTGTGTTTATCT
ACTTCTGGATTTTCTCAACTCCAGTTGTCTCCCTCATATTTGGTAGTTACCTATATATCTGCATCAACTGGTTCCACATA
CACTTTGATGAAGCCTTCTCTTCGTTGCGTATTGCAAACTACAAATCATTCACAAGATTCCACATTAAGAAGGATGGTAA
CCTGGAAATATTCACGCTTGCAGTAGACAAGGTCCCAAAGGATTGGAAATTGGATCCCAAGTGGGAGGCAGAGGAAAGGA
GGCCTCATCAGCTCAGCCATCACCGGAAGCACCCCAGCAAGTGGAGGTCATCCTCTTCCCCAGACCCTGTCACGTCGGTA
CGGGTTGTCGACCATTTCACCATTTCAAGAACAAGAACATCAGATCCCAACACCTCTTGTTGA

No homologs available

# RetrogeneDB ID Identity (%) Coverage (%) ORF conservation Expression evidence RDV
1. retro_oniv_10 73.21 97.30
Please wait, loading
Please wait, loading
Please wait, loading

Download FASTA sequences of all ONIVA01G47760 retrocopies