Parental gene:

TIMM9, ENSTSYG00000000502

Aliases:None
Description:translocase of inner mitochondrial membrane 9 homolog (yeast) [Source:HGNC Symbol;Acc:11819]
Organism:Tarsier (Tarsius syrichta)
Coordinates:GeneScaffold_7893:13279..15275(-)


>ENSTSYG00000000502
ATGGCTACACAAATACCAGAATCTGATCAGATAAAGCAGTTTAAGGAATTCCTTGGTACCTACAATAAGCTTACAGAAAC
CTGCTTTTTGGCCTGTGTTAAAGACTTCACAACAAGAGAAGTAAAACCTGAAGAGACCACCTGTTCAGAACATTGCTTAC
AGAAATATTTAAAAATGACACAAAGAATATCCATGAGATTTCAGGAATATCATATTCAGCAGAATGAAGCCCTGGCAGCC
AAAGCAGGACTCCTTGGCCAACCACGATAG

Species Parental gene accession Homology type Retrogenes number
Ailuropoda melanoleuca ENSAMEG00000002589 ortholog_one2one 1 retrogene
retro_amel_496,
Bos taurus ENSBTAG00000010503 ortholog_one2one 2 retrogenes
retro_btau_1154, retro_btau_1355,
Cavia porcellus ENSCPOG00000020422 ortholog_one2one 5 retrogenes
retro_cpor_1080, retro_cpor_1115, retro_cpor_484, retro_cpor_719, retro_cpor_881,
Dasypus novemcinctus ENSDNOG00000014822 ortholog_one2one 4 retrogenes
retro_dnov_1495, retro_dnov_177, retro_dnov_804, retro_dnov_820,
Dipodomys ordii ENSDORG00000002185 ortholog_one2one 2 retrogenes
retro_dord_343, retro_dord_729,
Equus caballus ENSECAG00000017063 ortholog_one2one 1 retrogene
retro_ecab_161,
Echinops telfairi ENSETEG00000014123 ortholog_one2one 8 retrogenes
retro_etel_1494, retro_etel_1551, retro_etel_1603, retro_etel_1986, retro_etel_1994, retro_etel_2201, retro_etel_760, retro_etel_778,
Felis catus ENSFCAG00000010833 ortholog_one2one 2 retrogenes
retro_fcat_1296, retro_fcat_465,
Homo sapiens ENSG00000100575 ortholog_one2one 2 retrogenes
retro_hsap_1260, retro_hsap_692,
Loxodonta africana ENSLAFG00000008658 ortholog_one2many 1 retrogene
retro_lafr_34,
Macropus eugenii ENSMEUG00000003698 ortholog_one2one 2 retrogenes
retro_meug_1499, retro_meug_314,
Microcebus murinus ENSMICG00000011791 ortholog_one2one 3 retrogenes
retro_mmur_1263, retro_mmur_680, retro_mmur_963,
Monodelphis domestica ENSMODG00000007898 ortholog_one2one 2 retrogenes
retro_mdom_1338, retro_mdom_920,
Nomascus leucogenys ENSNLEG00000013292 ortholog_one2one 2 retrogenes
retro_nleu_2098, retro_nleu_2226,
Otolemur garnettii ENSOGAG00000002472 ortholog_one2many 2 retrogenes
retro_ogar_359, retro_ogar_37,
Ochotona princeps ENSOPRG00000002924 ortholog_one2one 1 retrogene
retro_opri_693,
Procavia capensis ENSPCAG00000003568 ortholog_one2one 1 retrogene
retro_pcap_398,
Pongo abelii ENSPPYG00000005859 ortholog_one2one 2 retrogenes
retro_pabe_1049, retro_pabe_530,
Pan troglodytes ENSPTRG00000006394 ortholog_one2one 2 retrogenes
retro_ptro_3041, retro_ptro_496,
Sorex araneus ENSSARG00000012165 ortholog_one2one 1 retrogene
retro_sara_235,
Sus scrofa ENSSSCG00000027270 ortholog_one2one 2 retrogenes
retro_sscr_595, retro_sscr_596,
Tursiops truncatus ENSTTRG00000008743 ortholog_one2one 1 retrogene
retro_ttru_1011,

# RetrogeneDB ID Identity (%) Coverage (%) ORF conservation Expression evidence RDV
1. retro_tsyr_104 95.51 100.00
Please wait, loading
Please wait, loading
Please wait, loading
2. retro_tsyr_241 68.06 79.78
Please wait, loading
Please wait, loading
Please wait, loading
3. retro_tsyr_370 79.78 100.00
Please wait, loading
Please wait, loading
Please wait, loading
4. retro_tsyr_1026 68.06 79.78
Please wait, loading
Please wait, loading
Please wait, loading
5. retro_tsyr_1441 80.23 95.51
Please wait, loading
Please wait, loading
Please wait, loading
Download FASTA sequences of all ENSTSYG00000000502 retrocopies