Parental gene: | ENY2, ENSTBEG00000000273 |
| Aliases: | None |
| Description: | enhancer of yellow 2 homolog (Drosophila) [Source:HGNC Symbol;Acc:24449] |
| Organism: | Treeshrew (Tupaia belangeri) |
| Coordinates: | GeneScaffold_1786:147437..153098(+) |
>ENSTBEG00000000273
GTCCAGGTTAGCAAGATGAACAAAGATGCGCAGATGAGAGCAGCGATTAACCAAAAGTTGATAGAAACTGGAGAAAGAGA
ACGCCTCAAAGAGTTGCTGAGAGCTAAATTAATTGAATGTGGCTGGAAGGATCAATTGAAGGCACACTGTAAAGAGGTAA
TTAAAGAAAAAGGACTAGAACACGTTACTGTTGATGACTTGGTGGCTGAAATCACTCCAAAAGGCAGAGCCCTGGTACCT
GACAGTGTAAAGAAGGAGCTCCTACAAAGAATAAGAACATTCCTTGCTCAGCATGCCAGCCTTTAA
| Species | Parental gene accession | Homology type | Retrogenes number | |
|---|---|---|---|---|
| Anolis carolinensis | ENSACAG00000003039 | ortholog_one2many | 1 retrogene | |
| Callithrix jacchus | ENSCJAG00000006389 | ortholog_one2one | 4 retrogenes | |
| Cavia porcellus | ENSCPOG00000010988 | ortholog_one2one | 1 retrogene | |
| Dasypus novemcinctus | ENSDNOG00000007377 | ortholog_one2one | 1 retrogene | |
| Echinops telfairi | ENSETEG00000010882 | ortholog_one2one | 2 retrogenes | |
| Microcebus murinus | ENSMICG00000012948 | ortholog_one2one | 3 retrogenes | |
| Myotis lucifugus | ENSMLUG00000027585 | possible_ortholog | 1 retrogene | |
| Macaca mulatta | ENSMMUG00000006104 | ortholog_one2one | 2 retrogenes | |
| Pongo abelii | ENSPPYG00000025888 | ortholog_one2one | 1 retrogene | |
| Sarcophilus harrisii | ENSSHAG00000001787 | ortholog_one2many | 4 retrogenes | |
| Tursiops truncatus | ENSTTRG00000001742 | possible_ortholog | 3 retrogenes |
| # | RetrogeneDB ID | Identity (%) | Coverage (%) | ORF conservation | Expression evidence | RDV |
|---|---|---|---|---|---|---|
| 1. | retro_tbel_324 | 83.52 | 90.10 | Please wait, loading  |
Please wait, loading |
Please wait, loading |
| 2. | retro_tbel_823 | 89.90 | 98.02 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 3. | retro_tbel_2257 | 72.06 | 67.33 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 4. | retro_tbel_4307 | 60.24 | 77.23 | Please wait, loading |
Please wait, loading |
Please wait, loading |
Download FASTA sequences of all ENSTBEG00000000273 retrocopies