Parental gene:

Bo5g004420

Aliases:None
Description:None
Organism:Brassica oleracea
Coordinates:C5:1236090..1236975(-)


>Bo5g004420
ATGGCGGATGTTGAACCAGAGGTTGCTGCAGCTGGAGTCCCGAAGAAGAGGACGTTCAAGAAGTTTGCCTTCAAAGGAGT
CGATCTCGATGCTCTTCTCGACATGTCTACTGATGATCTCGTCAAGCTCTTCCCTTCTCGTATTCGCAGAAGGTTCTCTA
GAGGTTTGACCAGGAAGCCTATGGCTCTCATTAAGAAGCTGCGTAAGGCTAAAAGGGAGGCACCACAAGGTGAGAAGCCA
GAGCCAGTGAGAACCCACTTGAGGAACATGATCATTGTCCCAGAGATGATTGGAAGCATCATTGGAGTGTACAACGGAAA
GACGTTTAACCAAGTTGAGATCAAGCCTGAGATGATTGGTCACTACCTGGCTGAGTTCTCCATCTCATACAAGCCGGTTA
AGCACGGTAGGCCTGGTGTTGGTGCTACCCACTCCTCCAGGTTCATTCCTCTCAAGTGA

Species Parental gene accession Homology type Retrogenes number
Arabidopsis thaliana AT1G04270 ortholog_one2many 1 retrogene
Arabidopsis lyrata fgenesh2_kg.1__358__AT1G04270.1 ortholog_one2many 1 retrogene
Medicago truncatula MTR_1g070450 ortholog_many2many 1 retrogene
Solanum tuberosum PGSC0003DMG400007336 ortholog_many2many 1 retrogene
Solanum lycopersicum Solyc02g082000.2 ortholog_many2many 1 retrogene
Triticum aestivum Traes_2AL_52D3F9AF41 ortholog_many2many 1 retrogene

# RetrogeneDB ID Identity (%) Coverage (%) ORF conservation Expression evidence RDV
1. retro_bole_33 64.10 97.37
Please wait, loading
Please wait, loading
Please wait, loading

Download FASTA sequences of all Bo5g004420 retrocopies