
This is cutadapt 1.9 with Python 2.6.6
Command line parameters: -m 20 -A CTGTCTCTTATACACATCTGACGCTGCCGACGA -a CTGTCTCTTATACACATCTCCGAGCCCACGAGAC -o /scratch/AG_Ohler/rebecca/atacseq_gm12878_origPaper/50Kcells/rep1/SRR891268_1.cutadapt-m20_rev.fastq -p /scratch/AG_Ohler/rebecca/atacseq_gm12878_origPaper/50Kcells/rep1/SRR891268_2.cutadapt-m20_rev.fastq /scratch/AG_Ohler/rebecca/atacseq_gm12878_origPaper/50Kcells/rep1/SRR891268_1.fastq /scratch/AG_Ohler/rebecca/atacseq_gm12878_origPaper/50Kcells/rep1/SRR891268_2.fastq
Trimming 2 adapters with at most 10.0% errors in paired-end mode ...
Finished in 5535.29 s (29 us/read; 2.09 M reads/minute).

=== Summary ===

Total read pairs processed:          192904649
  Read 1 with adapter:                26211075 (13.6%)
  Read 2 with adapter:                26120665 (13.5%)
Pairs that were too short:              372391 (0.2%)
Pairs written (passing filters):     192532258 (99.8%)

Total basepairs processed:   19290464900 bp
  Read 1:    9645232450 bp
  Read 2:    9645232450 bp
Total written (filtered):    18828518862 bp (97.6%)
  Read 1:    9413769215 bp
  Read 2:    9414749647 bp

=== First read: Adapter 1 ===

Sequence: CTGTCTCTTATACACATCTCCGAGCCCACGAGAC; Type: regular 3'; Length: 34; Trimmed: 26211075 times.

No. of allowed errors:
0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-34 bp: 3

Bases preceding removed adapters:
  A: 12.0%
  C: 39.8%
  G: 25.4%
  T: 21.3%
  none/other: 1.4%

Overview of removed sequences
length	count	expect	max.err	error counts
3	4038144	3014135.1	0	4038144
4	2379344	753533.8	0	2379344
5	2065303	188383.4	0	2065303
6	2030342	47095.9	0	2030342
7	2022822	11774.0	0	2022822
8	2384105	2943.5	0	2384105
9	2322032	735.9	0	2310206 11826
10	1972879	184.0	1	1947641 25238
11	1518809	46.0	1	1501326 17483
12	1133183	11.5	1	1113746 19437
13	973309	2.9	1	959849 13460
14	874563	0.7	1	861557 13006
15	518247	0.2	1	509998 8249
16	272815	0.0	1	268353 4462
17	187515	0.0	1	184371 3144
18	143768	0.0	1	141200 2497 71
19	146944	0.0	1	144178 2731 35
20	153277	0.0	2	149959 3035 283
21	178130	0.0	2	173709 3939 482
22	158690	0.0	2	154204 4002 484
23	157334	0.0	2	152545 4215 574
24	183764	0.0	2	177584 5554 626
25	15682	0.0	2	15088 519 75
26	2748	0.0	2	2627 103 18
27	1932	0.0	2	1834 81 17
28	866	0.0	2	827 27 9 3
29	1750	0.0	2	1650 81 16 3
30	610	0.0	3	578 23 7 2
31	1053	0.0	3	1006 41 4 2
32	1152	0.0	3	1109 40 3
33	705	0.0	3	647 53 2 3
34	207	0.0	3	192 10 5
35	193	0.0	3	173 15 3 2
36	111	0.0	3	91 8 9 3
37	1893	0.0	3	1781 104 6 2
38	98	0.0	3	90 7 1
39	229	0.0	3	221 7 1
40	403	0.0	3	371 18 13 1
41	291	0.0	3	244 29 11 7
42	942	0.0	3	885 41 6 10
43	160	0.0	3	151 7 1 1
44	266	0.0	3	250 14 2
45	114	0.0	3	103 10 1
46	52	0.0	3	48 3 0 1
47	651	0.0	3	610 39 2
48	24	0.0	3	20 1 1 2
49	1517	0.0	3	1423 84 5 5
50	362107	0.0	3	327467 32105 1848 687

=== Second read: Adapter 2 ===

Sequence: CTGTCTCTTATACACATCTGACGCTGCCGACGA; Type: regular 3'; Length: 33; Trimmed: 26120665 times.

No. of allowed errors:
0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-33 bp: 3

Bases preceding removed adapters:
  A: 12.2%
  C: 39.7%
  G: 25.4%
  T: 21.3%
  none/other: 1.4%

Overview of removed sequences
length	count	expect	max.err	error counts
3	4048929	3014135.1	0	4048929
4	2372374	753533.8	0	2372374
5	2058672	188383.4	0	2058672
6	2022402	47095.9	0	2022402
7	2013626	11774.0	0	2013626
8	2375213	2943.5	0	2375213
9	2311848	735.9	0	2300411 11437
10	1963814	184.0	1	1936856 26958
11	1511444	46.0	1	1493106 18338
12	1126559	11.5	1	1107279 19280
13	967405	2.9	1	953575 13830
14	869277	0.7	1	855917 13360
15	514790	0.2	1	506232 8558
16	271052	0.0	1	266778 4274
17	186407	0.0	1	183453 2954
18	142611	0.0	1	140233 2356 22
19	146127	0.0	1	143489 2595 43
20	152414	0.0	2	148915 3071 428
21	177047	0.0	2	172805 3609 633
22	157585	0.0	2	153362 3574 649
23	156086	0.0	2	151368 4070 648
24	182259	0.0	2	176622 4842 795
25	15466	0.0	2	14841 506 119
26	2698	0.0	2	2589 90 19
27	1891	0.0	2	1814 62 15
28	854	0.0	2	815 32 6 1
29	1714	0.0	2	1638 53 18 5
30	593	0.0	3	544 34 10 5
31	1031	0.0	3	970 42 12 7
32	1089	0.0	3	1011 47 10 21
33	686	0.0	3	631 42 6 7
34	203	0.0	3	168 12 1 22
35	188	0.0	3	160 24 4
36	101	0.0	3	72 12 1 16
37	1873	0.0	3	1684 164 7 18
38	98	0.0	3	94 2 0 2
39	228	0.0	3	209 15 1 3
40	409	0.0	3	371 27 9 2
41	268	0.0	3	245 16 4 3
42	924	0.0	3	833 57 8 26
43	161	0.0	3	143 12 0 6
44	269	0.0	3	252 12 1 4
45	112	0.0	3	109 2 0 1
46	79	0.0	3	63 8 4 4
47	648	0.0	3	614 30 2 2
48	33	0.0	3	17 7 6 3
49	1534	0.0	3	1389 123 16 6
50	359574	0.0	3	325752 30705 2257 860

Sun Jan 31 02:31:45 CET 2016
-------- fini ---------------------------------
